Everything below concerns circadian rhythm. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2025-08-15. Where a claim depends on a specific study, the study is described rather than over-claimed.
Regulatory and sporting contexts treat SR9009 as a prohibited substance in many elite competitions. Its presence on banned lists reflects concerns about performance enhancement and unknown long-term safety. Analytical chemists have developed methods to detect the parent compound and its metabolites in urine and blood. Literature discussions distinguish between in vitro potency, animal pharmacology, and anecdotal human reports. The latter are difficult to verify because products sold online may lack purity or contain different compounds.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. These receptors help regulate circadian rhythms, lipid metabolism, and inflammatory gene expression. In cell and animal experiments, SR9009 alters transcription of clock-controlled genes and metabolic pathways. The compound is not a hormone and does not resemble classical steroid structures. Its activity depends on binding to the ligand-binding domain of REV-ERB, where it can modify corepressor recruitment.
Regulatory treatment of SR9009 reflects its investigational status. The compound has no approved human therapeutic indication, and sports authorities prohibit its use. It appears on anti-doping lists as a non-approved substance or metabolic modulator, depending on the list version. Products sold online as research chemicals are not quality-controlled medicines, so their identity and purity can differ from the label. Such products may also contain unlisted compounds, which complicates both testing and safety assessment.
Scientific discussion of SR9009 often separates animal evidence from human anecdote. Rodent studies provide controlled data on endurance, metabolism, and gene expression, but they use specific strains, doses, and treatment durations. Human reports are mostly uncontrolled and cannot establish cause and effect. Open questions include oral bioavailability, tissue distribution, metabolic stability, and long-term effects. Review articles generally call for more rigorous pharmacokinetic and safety research before any clinical use could be considered.
Analytical methods for SR9009 typically rely on liquid chromatography coupled with tandem mass spectrometry. The technique can separate the parent compound from related substances and detect low concentrations in biological matrices. Urine and blood are common samples in anti-doping testing, while in vitro studies may use cell culture media. Rapid metabolism and low expected concentrations make method validation important for reliable identification. Exact metabolite patterns can vary by species and are not fully mapped.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic REV-ERB agonist | Binds REV-ERBα and REV-ERBβ in preclinical models |
| Molecular formula | C20H24ClN3O4S | Reported for the parent compound |
| CAS Registry Number | 1379686-30-2 | Common identifier in chemical databases |
| Appearance | Off-white to pale yellow solid | Typical research chemical solid |
| Solubility | Soluble in DMSO and ethanol; low in water | Class: small organic molecule |
SR9009 stability depends on temperature, moisture, light, and solvent. Solid material is generally kept cool and dry, while solutions may require protection from repeated warming and cooling. Degradation can appear as color changes, precipitate, or new chromatographic peaks. Researchers should follow supplier instructions and their own stability data. Long-term storage conditions for human use have not been established because the compound lacks approved clinical formulation.
SR9009 is supplied as a solid research chemical, often in milligram quantities. Laboratories typically weigh it in a controlled environment because fine powders can disperse. Stock solutions are commonly prepared in dimethyl sulfoxide and stored in small aliquots to reduce freeze-thaw cycles. Personal protective equipment and chemical fume hoods are standard when handling unknown or potent compounds. These practices address laboratory safety rather than human use.
Poly(ADP-ribose)polymerases (PARPs) are found mostly in eukaryotes and catalyze the transfer of multiple ADP-ribose molecules to target proteins. As with mono(ADP-ribosyl)ation, the source of ADP-ribose is NAD+. PARPs use a catalytic triad of His-Tyr-Glu to facilitate binding of NAD+ and positioning of the end of the existing poly(ADP-ribose) chain on the target protein; the Glu facilitates catalysis and formation of a (1''→2') O-glycosidic linkage between two ribose molecules. There are several other enzymes that recognize poly(ADP-ribose) chains, hydrolyse them or form branches; over 800 proteins have been annotated to contain the loosely defined poly(ADP-ribose) binding motif; therefore, in addition to this modification altering target protein conformation and structure, it may also be used as a tag to recruit other proteins or for regulation of the target protein.
=== Israeli stamps === Kuwait, Lebanon, Libya, and Yemen do not allow entry to people with passport stamps from Israel or whose passports have either a used or an unused Israeli visa, or where there is evidence of previous travel to Israel such as entry or exit stamps from neighbouring border posts in transit countries such as Jordan and Egypt. To circumvent this Arab League boycott of Israel, the Israeli immigration services have now mostly ceased to stamp foreign nationals' passports on either entry to or exit from Israel (unless the entry is for some work-related purposes). Since 15 January 2013, Israel no longer stamps foreign passports at Ben Gurion Airport. Passports are still (as of 22 June 2017) stamped at Erez when passing into and out of Gaza. Iran refuses admission to holders of passports containing an Israeli visa or stamp that is less than 12 months old.
Microorganisms have a much higher growth rate (algae: 2–6 hours, yeast: 1–3 hours, bacteria: 0.5–2 hours). This also allows selection for strains with high yield and good nutritional composition more quickly and easily compared to breeding. Whereas large parts of crops, such as stems, leaves and roots, are not edible, single-cell microorganisms can be used entirely. Whereas parts of the edible fraction of crops are indigestible, many microorganisms are digestible at a much higher fraction. Microorganisms usually have a much higher protein content of 30–70% in the dry mass than vegetables or grains. The amino acid profiles of many SCP microorganisms often have excellent nutritional quality, comparable to hen's eggs. Some microorganisms can build vitamins and nutrients which eukaryotic organisms such as plants cannot produce or not produce in significant amounts, including vitamin B12. Microorganisms can utilize a broad spectrum of raw materials as carbon sources including alkanes, methanol, methane, ethanol and sugars. What was considered "waste product" often can be reclaimed as nutrients and support growth of edible microorganisms. Like plants, autotrophic microorganisms are capable of growing on CO2. Some of them, such as bacteria with the Wood–Ljungdahl pathway or the reductive TCA can fix CO2 with efficiencies ranging from 2-3 times to 10 times more efficiently than plants, when also considering the effects of photoinhibition. Some bacteria, such as several homoacetogenic clostridia, are capable of performing syngas fermentation.
==== Dentine sensitivity ==== Nano-hydroxyapatite possesses bioactive components which can prompt the mineralisation process of teeth, remedying hypersensitivity. Hypersensitivity of teeth is thought to be regulated by fluid within dentinal tubules. The movement of this fluid as a result of different stimuli is said to excite receptor cells in the pulp and trigger sensations of pain. The physical properties of the nano-hydroxyapatite can penetrate and seal the tubules, stopping the circulation of the fluid and therefore the sensations of pain from stimuli. Nano-hydroxyapatite would be preferred as it parallels the natural process of surface remineralisation. In comparison to alternative treatments for dentine hypersensitivity relief, nano-hydroxyapatite containing treatment has been shown to perform better clinically. Nano-hydroxyapatite was proven to be better than other treatments at reducing sensitivity against evaporative stimuli, such as an air blast, and tactile stimuli, such as tapping the tooth with a dental instrument. However, no difference was seen between nano-hydroxyapatite and other treatments for cold stimuli. Hydroxylapatite has shown significant medium and long-term desensitizing effects on dentine hypersensitivity using evaporative stimuli and the visual analogue scale (alongside potassium nitrate, arginine, glutaraldehyde with hydroxyethyl methacrylate, hydroxyapatite, adhesive systems, glass ionomer cements and laser).
Sources: en.wikipedia.org
==== Mass spectrometry ==== Since alkanes have high ionization energies, their electron impact mass spectra show weak currents for their molecular ions. The fragmentation pattern can be difficult to interpret, but in the case of branched chain alkanes, the carbon chain is preferentially cleaved at tertiary or quaternary carbons due to the relative stability of the resulting free radicals. The mass spectra for straight-chain alkanes is illustrated by that for dodecane: the fragment resulting from the loss of a single methyl group (M − 15) is absent, fragments are more intense than the molecular ion and are spaced by intervals of 14 mass units, corresponding to loss of CH2 groups.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
2 March – Bertie O'Brien, 71, Gaelic footballer and hurler (St. Finbarr's, Cork senior teams). 3 March Camille Souter, 93, artist. Rita O'Hare, 80, Republican activist. 5 March – Maurice Scully, 70, poet. 10 March – Niall Brophy, 87, rugby union player (Leinster, national team, Lions). 12 March – Liam Kearns, 61, Gaelic footballer (Austin Stacks, Kerry senior team) and manager (Limerick, Laois, Tipperary, Offaly). 13 March – Tom Ryan, 81, hurler (Killenaule, Éire Óg, James Stephens, Tipperary senior team). 22 March – Marcus Wilson, 91, Gaelic footballer (St. Vincent's, Dublin senior teams). 25 March – Ger Glavin, 66, hurler (Midleton) and Gaelic footballer (Ballincollig, Imokilly, Cork senior team). 28 March – Jimmy Gray, 93, Gaelic footballer and hurler (Na Fianna, Dublin senior teams). 31 March – Harry Cassidy, 92, Gaelic footballer and manager (Bellaghy, Derry senior team). Born in Northern Ireland.
== Businesses and organizations == Rainforest Partnership, an environmental organization based in Austin, Texas RallyPoint, a social network for the US military Reform Party (Singapore), an opposition party in Singapore led by Kenneth Jeyaretnam Republic Polytechnic, a polytechnic in Singapore Rheinische Post, a German newspaper Rhône-Poulenc, a former French chemical company Royal Society of Portrait Painters (London), with membership indicated RP Roma Party (Romska partija), a political party in Serbia Welfare Party, or Refah Partisi, in Turkey Chautauqua Airlines, the IATA airline designator RP
1908 saw a boom in the use of radioactive water for therapeutic purposes. The discovery of springs in Oberschlema and Bad Brambach paved the way for the establishment of radium spas, which relied on the healing properties of radium. During the cures, people bathed in radium water, drank cures with radium water, and inhaled radon in emanatoriums. The baths were visited by tens of thousands of people every year, hoping for hormesis. To this day, therapeutic applications are carried out in spas and healing tunnels. The natural release of radon from the ground is used. According to the German Spa Association, the activity in water must be at least 666 Bq/liter. The requirement for inhalation treatments is at least 37,000 Bq/m3 of air. This form of therapy is not scientifically accepted and the potential risk of radiation exposure is criticized. The equivalent dose of a radon cure in Germany is given by the individual health resorts as about one to two millisieverts, depending on the location. In 2010, doctors in Erlangen, using the (outdated) LNT (Linear, No-Threshold) model, concluded that five percent of all lung cancer deaths in Germany are caused by radon.
Sources: en.wikipedia.org
=== Traditional isotope systems === The compounds used as isotopic references have a relatively complex history. The broad evolution of reference materials for the hydrogen, carbon, oxygen, and sulfur stable isotope systems are shown in Figure 1. Materials with red text define the primary reference commonly reported in scientific publications and materials with blue text are those available commercially. The hydrogen, carbon, and oxygen isotope scales are defined with two anchoring reference materials. For hydrogen the modern scale is defined by VSMOW2 and SLAP2, and is reported relative to VSMOW. For carbon the scale is defined by either NBS-19 or IAEA-603 depending on the age of the lab, as well as LSVEC, and is reported relative to VPDB. Oxygen isotope ratios can be reported relative to either the VSMOW or VPDB scales. The isotopic scales for sulfur and nitrogen are both defined for only a single anchoring reference material. For sulfur the scale is defined by IAEA-S-1 and is reported relative to VCDT, while for nitrogen the scale is both defined by and reported relative to AIR.
Increased appetite, weight gain, nausea, malaise, Increased risk of infection Cardiovascular events Dermatological effects including reddening of the face, bruising/skin discoloration, impaired wound healing, skin atrophy, skin rash, edema, and abnormal hair growth Hyperglycemia; patients with diabetes may need increased insulin or diabetic therapies Menstrual abnormalities Lower response to hormones, especially during stressful instances such as surgery or illness Change in electrolytes: rise in blood pressure, increased sodium and low potassium, leading to alkalosis Gastrointestinal system effects: swelling of the stomach lining, reversible increase in liver enzymes, and risk of stomach ulcers Muscular and skeletal abnormalities, such as muscle weakness/muscle loss, osteoporosis (see steroid-induced osteoporosis), long bone fractures, tendon rupture, and back fractures Neurological effects, including involuntary movements (convulsions), headaches, and vertigo Psychosocial behavioral and emotional disturbances with aggression being one of the most common cognitive symptoms, especially with oral use. Nasal septum perforation and bowel perforation (in some pathologic conditions). Discontinuing prednisolone after long-term or high-dose use can lead to adrenal insufficiency. Mania and hypomania are known possible side effects of prednisolone.
=== April === 7 April – It was announced that the Leaving Certificate grinds school, the Institute of Education in Dublin with 7,000 pupils, founded by Ray Kearns in 1969, had been sold to a British educational company. 9 April – An emergency was declared and flights into Dublin Airport were suspended briefly when the nose landing gear of a Ryanair flight from Liverpool to Dublin experienced a problem during landing. Four other arriving flights were diverted to Shannon Airport. Visit by Joe Biden
== Other uses == Relief pitcher, a baseball term Registered Paralegal, a certification program of the National Federation of Paralegal Associations Riot Points (used in League of Legends) Regimental Police or Regimental Provost, soldiers responsible for regimental discipline and unit custody in the British Army Role-playing Rating Pending, a rating used by ESRB in promotional games that has lacked a rating.
In June 1964, 144 test persons survived for six days in a civilian nuclear bunker. The bunker in Dortmund had been built during the Second World War and had been converted at great expense in the early 1960s into a nuclear-weapon-proof building. However, it would be impossible to build a bunker for millions of German citizens. The Swiss Army built about 7800 nuclear fallout shelters in 1964. In the United States in particular, but also Europe, citizens built private fallout shelters in their front yards on their initiative. This construction was largely kept secret because the owners feared that third parties might take possession of the bunker in the event of a crisis.
Sources: en.wikipedia.org
SR9009 is a synthetic small molecule studied as an agonist of the REV-ERB nuclear receptors. It is not an approved medicine, and its effects in humans are not well characterized.
No. It is a synthetic ligand that binds nuclear receptors, not a steroid or peptide hormone. Its activity depends on receptor binding rather than endocrine secretion.
Clinical evidence is limited. Most published data come from cell and animal experiments. Human safety and efficacy remain uncertain.
No. It is an investigational compound without approved therapeutic indications. It is sold for research purposes only in many jurisdictions.